Φωτογραφίες / ήχοι

Παρατηρητής

rahunt2

Ημερομηνία

Μάιος 15, 2009

Τόπος

Costa Rica (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

uwkwaj

Ημερομηνία

Μάιος 6, 2019

Φωτογραφίες / ήχοι

Παρατηρητής

brian_r_mayes

Ημερομηνία

Μάιος 1, 2022 08:02 AM AEST

Φωτογραφίες / ήχοι

Παρατηρητής

disciseda

Ημερομηνία

Αύγουστος 25, 2010 11:48 AM MDT

Φωτογραφίες / ήχοι

Παρατηρητής

kevinhintsa

Ημερομηνία

Μάιος 2022

Τόπος

Ιδιωτικό

Περιγραφή

Contra Costa County , California . Known site , exact location not shown .

Φωτογραφίες / ήχοι

Παρατηρητής

luca_hickey

Ημερομηνία

Δεκέμβριος 17, 2019

Περιγραφή

Interesting

Φωτογραφίες / ήχοι

Παρατηρητής

jlippert2218

Ημερομηνία

Νοέμβριος 1, 2020 03:00 PM PST

Περιγραφή

On cantharellus cascadensis. Located by Melissa Johnson-Ravare. T21S R5E Sec 36 NW4 3500 ft elevation

Φωτογραφίες / ήχοι

Παρατηρητής

yanivsegal

Ημερομηνία

Μάρτιος 2022

Τόπος

Israel (Google, OSM)

Περιγραφή

Calongea prieguensis

Φωτογραφίες / ήχοι

Παρατηρητής

luca_hickey

Ημερομηνία

Σεπτέμβριος 27, 2020 10:10 AM PDT

Φωτογραφίες / ήχοι

Παρατηρητής

jgarciapelayohsu

Ημερομηνία

Δεκέμβριος 9, 2021 09:55 AM PST

Φωτογραφίες / ήχοι

Παρατηρητής

betweenthelyons

Ημερομηνία

Μάρτιος 2022

Τόπος

California, US (Google, OSM)

Περιγραφή

Lots in burn zone

Φωτογραφίες / ήχοι

Παρατηρητής

sarasota_manatee_ecoflora_sean

Ημερομηνία

Μάρτιος 2022

Τόπος

Florida, US (Google, OSM)

Περιγραφή

Additional photos and close ups of main individual.

Φωτογραφίες / ήχοι

Παρατηρητής

corndog

Ημερομηνία

Μάρτιος 22, 2022 08:18 PM PDT

Φωτογραφίες / ήχοι

Παρατηρητής

morganstickrod

Ημερομηνία

Μάρτιος 2022

Φωτογραφίες / ήχοι

Παρατηρητής

riverahlquist

Ημερομηνία

Μάρτιος 17, 2022 01:38 PM CDT

Φωτογραφίες / ήχοι

Παρατηρητής

lilcar

Ημερομηνία

Ιούνιος 5, 2021 04:53 PM CEST

Τόπος

Aiguines, France (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

logancrees

Ημερομηνία

Μάρτιος 10, 2022 11:09 AM CST

Φωτογραφίες / ήχοι

Παρατηρητής

malacothrix

Ημερομηνία

Ιανουάριος 15, 2022 11:54 AM PST

Περιγραφή

SOMA foray

Found amongst Umbellularia californica and Psuedotsuga menziesii with scattered Quercus agrifolia nearby

Φωτογραφίες / ήχοι

Παρατηρητής

jennykeeping

Ημερομηνία

Δεκέμβριος 20, 2018 05:55 AM SAST

Φωτογραφίες / ήχοι

Παρατηρητής

ymwang

Ημερομηνία

Φεβρουάριος 1, 2022 11:13 AM UTC

Φωτογραφίες / ήχοι

Παρατηρητής

ymwang

Ημερομηνία

Φεβρουάριος 18, 2022 03:38 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

lizziepop

Ημερομηνία

Ιανουάριος 30, 2009

Περιγραφή

Bulbous Mushroom


Ball shaped cap when young and purple-pinkish colour. Becoming flat and caramel brown, Bulbous clavate stem, creamy lamellae,cap diameter 4-5,5cm, height 5cm, bulb diameter 3-4,5cm, growing under Tipiana

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

stucumber_

Ημερομηνία

Φεβρουάριος 10, 2019 02:48 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

biocowboy

Ημερομηνία

Μάρτιος 4, 2022 01:47 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

nikborrow

Ημερομηνία

Ιανουάριος 31, 2022

Φωτογραφίες / ήχοι

Παρατηρητής

dannymi

Ημερομηνία

Νοέμβριος 5, 2018

Τόπος

PSMS ID Clinic (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

claudia_jeannette

Ημερομηνία

Οκτώβριος 2011

Τόπος

La Paz, MX-BS, MX (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

garmonb0zia

Ημερομηνία

Μάρτιος 21, 2019 12:27 PM PDT

Περιγραφή

Growing on ericameria stem, strongly farinaceous odor.

Φωτογραφίες / ήχοι

Παρατηρητής

chloe_and_trevor

Ημερομηνία

Ιανουάριος 8, 2022 06:16 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

melsocal

Ημερομηνία

Φεβρουάριος 21, 2022 10:42 AM PST

Φωτογραφίες / ήχοι

Παρατηρητής

fungee

Ημερομηνία

Ιούλιος 2019

Τόπος

New York, US (Google, OSM)

Περιγραφή

red oak, hemlock, yellow birch

Ετικέτες

c7

Φωτογραφίες / ήχοι

Παρατηρητής

andesgascon_alex

Ημερομηνία

Απρίλιος 6, 2020

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

morganstickrod

Ημερομηνία

Νοέμβριος 2020

Τόπος

California, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

danielle775

Ημερομηνία

Αύγουστος 25, 2021 08:06 AM UTC

Περιγραφή

Growing on decomposing White Birch

Φωτογραφίες / ήχοι

Παρατηρητής

chelseamcd

Ημερομηνία

Μάιος 19, 2020

Τόπος

Castlegar (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

autumna

Ημερομηνία

Νοέμβριος 15, 2020 01:48 PM PST

Τόπος

Alsea Falls Area (Google, OSM)

Περιγραφή

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Φωτογραφίες / ήχοι

Παρατηρητής

chuckie1997

Ημερομηνία

Οκτώβριος 24, 2020 07:13 PM PDT

Τόπος

Beaverton (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

brettjackson

Ημερομηνία

Φεβρουάριος 17, 2022 02:09 PM CST

Περιγραφή

On the underside of Quercus pagoda leaf. A few alate individuals present.

White coloring nearby is probably the mycelial mat formed by Erysiphe abbreviata, often found hypophyllous on Q. pagoda .

Φωτογραφίες / ήχοι

Παρατηρητής

leptonia

Ημερομηνία

Μάιος 29, 2020 09:15 AM PDT

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

tmurray74

Ημερομηνία

Μάρτιος 2014

Τόπος

United States (Google, OSM)

Περιγραφή

Echinodontium ballouii wasn't seen for 100 years until Larry Millman found it in an Atlantic White Cedar swamp. Larry took me to the site, (which I can't say where it is) and we found about a dozen of these again 4 years after the first visit.

Φωτογραφίες / ήχοι

Παρατηρητής

dwborland

Ημερομηνία

Ιούλιος 28, 2013 06:12 PM EDT

Περιγραφή

Leucopaxillus gracillimus.0182.7.28.13.dwb/alachua co. florida

rather uncommon

syn. Clitocybe rappiana

Φωτογραφίες / ήχοι

Παρατηρητής

silversea_starsong

Ημερομηνία

Μάρτιος 5, 2017 09:21 AM PST

Φωτογραφίες / ήχοι

Παρατηρητής

kschnei

Ημερομηνία

Απρίλιος 18, 2019 11:44 AM PDT

Περιγραφή

Tiny 1-mm springtail swept from grasses and collected temporarily for photomicrographs.

Φωτογραφίες / ήχοι

Παρατηρητής

rtshaw80

Ημερομηνία

Μάρτιος 27, 2015 10:56 AM CDT

Φωτογραφίες / ήχοι

Παρατηρητής

rtshaw80

Ημερομηνία

Μάρτιος 24, 2015 12:33 PM CDT

Φωτογραφίες / ήχοι

Παρατηρητής

rtshaw80

Ημερομηνία

Μάρτιος 24, 2015 08:06 AM CDT

Φωτογραφίες / ήχοι

Παρατηρητής

dgreenberger

Ημερομηνία

Φεβρουάριος 6, 2022 04:51 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

panarthropodism

Ημερομηνία

Απρίλιος 18, 2021 02:24 PM EDT

Φωτογραφίες / ήχοι

Παρατηρητής

alison_pollack

Ημερομηνία

Φεβρουάριος 4, 2022 03:35 PM HST

Περιγραφή

I was thrilled when @graysquirrel found these as we were poking around the woods together! Such a beautiful species!

Φωτογραφίες / ήχοι

Παρατηρητής

kdff

Ημερομηνία

Ιανουάριος 28, 2022

Περιγραφή

On Toyon berries, Heteromeles arbutifolia.

Φωτογραφίες / ήχοι

Παρατηρητής

mycotrope

Ημερομηνία

Μάιος 30, 2015 02:28 PM PDT

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

kestrel

Ημερομηνία

Ιανουάριος 30, 2022 03:31 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

colinpurrington

Ημερομηνία

Ιούλιος 25, 2017 04:01 PM EDT

Τόπος

Glasco, NY, USA (Google, OSM)

Περιγραφή

On Dacrymyces (I think).

Φωτογραφίες / ήχοι

Παρατηρητής

wangchuk

Ημερομηνία

Αύγουστος 22, 2021 09:35 AM +06

Τόπος

Bumthang, Bhutan (Google, OSM)

Περιγραφή

Alpine screes

Φωτογραφίες / ήχοι

Παρατηρητής

malacothrix

Ημερομηνία

Δεκέμβριος 10, 2021 12:41 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

betweenthelyons

Ημερομηνία

Ιανουάριος 21, 2022 03:52 PM UTC

Φωτογραφίες / ήχοι

Παρατηρητής

spencer_wimmer

Ημερομηνία

Ιούλιος 25, 2021 01:42 PM MDT

Φωτογραφίες / ήχοι

Παρατηρητής

faerthen

Ημερομηνία

Μάιος 19, 2018 12:13 PM PDT

Περιγραφή

Turned him up cleaning the glass. This is the biggest sculpin I've ever seen in the creek, though the camera lens wants to make my fingers look bigger than they are relative to the fish.

Φωτογραφίες / ήχοι

Παρατηρητής

crabsandshrimps

Ημερομηνία

Ιούλιος 13, 2010 08:05 AM PDT

Φωτογραφίες / ήχοι

Παρατηρητής

alex_bairstow

Ημερομηνία

Ιανουάριος 20, 2019 05:01 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

chloe_and_trevor

Ημερομηνία

Δεκέμβριος 26, 2021 12:59 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

damontighe

Ημερομηνία

Μάιος 27, 2019 09:57 AM PDT

Φωτογραφίες / ήχοι

Παρατηρητής

kueda

Ημερομηνία

Φεβρουάριος 12, 2021 10:32 AM PST

Περιγραφή

Found several under rocks and logs on a rocky, grassy hillside, maybe 1-2 mm long, fairly active. I think these should be called candy cane mites or Christmas mites.

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

thomaseverest

Ημερομηνία

Δεκέμβριος 29, 2017

Περιγραφή

In beached driftwood, third photo is young found brooding in the gills of larger individuals

Φωτογραφίες / ήχοι

Παρατηρητής

flygrl67

Ημερομηνία

Ιανουάριος 2022

Περιγραφή

Chartreuse colored cap, bulb, and mycelial threads; reddish brown discolorations on cap; olivaceus-black KOH rxn on cap

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

flygrl67

Ημερομηνία

Ιανουάριος 2022

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

imlichentoday

Ημερομηνία

Σεπτέμβριος 16, 2021 10:00 AM PDT

Περιγραφή

Garden Spot East Anacapa ~25ft

Φωτογραφίες / ήχοι

Παρατηρητής

mzuckerfish

Ημερομηνία

Οκτώβριος 2021

Φωτογραφίες / ήχοι

Παρατηρητής

uwkwaj

Ημερομηνία

Νοέμβριος 27, 2021 10:35 AM PST

Φωτογραφίες / ήχοι

Παρατηρητής

maricel-patino

Ημερομηνία

Δεκέμβριος 11, 2021 02:25 AM EST

Περιγραφή

On abandoned fire wood. Hidden against ground and adding and growing on debris. 4 pores per mm.
Bruising pinkish. Spores: 3.7-4 x 4.9-5.4 with drop. Basidia: up to 37 x 7.4 um with four sterigmata. Lots of cystidia with round and pointy ends. Pine Barrens.

Φωτογραφίες / ήχοι

Παρατηρητής

dr_q

Ημερομηνία

Ιούνιος 27, 2019 02:59 PM PDT

Περιγραφή

Not an insect! Springtails are a different Class. This particular springtail is a golden snowflea.

Φωτογραφίες / ήχοι

Παρατηρητής

dlbowls

Ημερομηνία

Ιανουάριος 2017

Περιγραφή

The orange ones. Our ID is based on comparison to pictures on Bugguide.net. We are hoping for confirmation from them.

Φωτογραφίες / ήχοι

Παρατηρητής

glmory

Ημερομηνία

Φεβρουάριος 16, 2017 06:50 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

cedric_lee

Ημερομηνία

Μάρτιος 4, 2017 11:09 AM PST

Φωτογραφίες / ήχοι

Παρατηρητής

divindk

Ημερομηνία

Απρίλιος 25, 2021 10:04 AM PDT

Περιγραφή

Podocerus cristatus amphipod at Santa Cruz Island, CA. Depth 60' / 20M. Water temp 50 degrees F

Φωτογραφίες / ήχοι

Παρατηρητής

sea-kangaroo

Ημερομηνία

Οκτώβριος 19, 2018 09:20 AM PDT

Περιγραφή

Dive site Emerald Cove, max depth 61ft/19m.

Decently large (~4" diameter) solitary anemone.

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

uwkwaj

Ημερομηνία

Νοέμβριος 13, 2021

Περιγραφή

With egg masses

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

socal_angling

Ημερομηνία

Ιανουάριος 9, 2022 10:48 AM UTC

Περιγραφή

Parasitic isopod on the tail of a white surfperch

Φωτογραφίες / ήχοι

Παρατηρητής

jonaleef

Ημερομηνία

Αύγουστος 2021

Τόπος

United States (Google, OSM)

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

dgreenberger

Ημερομηνία

Ιανουάριος 2021

Τόπος

California, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

mcduck

Ημερομηνία

Σεπτέμβριος 15, 2015

Περιγραφή

27mm length. Second photo is close-up of rhinophore. Specimen at CASIZ 208937.

Φωτογραφίες / ήχοι

Παρατηρητής

anudibranchmom

Ημερομηνία

Ιούνιος 2016

Τόπος

California, US (Google, OSM)

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

leslieh

Ημερομηνία

Νοέμβριος 14, 2021

Περιγραφή

inverts from RV Yellowfin cruise_Dr. Kimo Morris' marine biology class

Φωτογραφίες / ήχοι

Παρατηρητής

zabbey

Ημερομηνία

Μάρτιος 7, 2019 10:45 AM PST

Περιγραφή

Verrucaria?

Φωτογραφίες / ήχοι

Παρατηρητής

gnomewardbound

Ημερομηνία

Μάρτιος 13, 2021 03:16 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

silversea_starsong

Ημερομηνία

Απρίλιος 2018

Φωτογραφίες / ήχοι

Παρατηρητής

kkellman

Ημερομηνία

Δεκέμβριος 2019

Τόπος

California, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

susanmf

Ημερομηνία

Μάρτιος 22, 2021 10:56 AM PDT

Φωτογραφίες / ήχοι

Παρατηρητής

acastelein

Ημερομηνία

Ιανουάριος 5, 2022 06:24 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

acastelein

Ημερομηνία

Ιανουάριος 5, 2022 06:33 PM PST

Φωτογραφίες / ήχοι

Παρατηρητής

naturecandids

Ημερομηνία

Ιανουάριος 2, 2022 12:51 PM PST

Περιγραφή

There were hundreds of these fellows in a small, seasonal pond (last photo).

Φωτογραφίες / ήχοι

Παρατηρητής

squamatologist

Ημερομηνία

Ιούνιος 5, 2008 12:09 PM CDT

Περιγραφή

Little Monardella (Monardella nana), eastern San Diego County, California

Φωτογραφίες / ήχοι

Παρατηρητής

robertdavis

Ημερομηνία

Σεπτέμβριος 25, 2019 08:42 AM PDT

Περιγραφή

Host mushroom chanterelle, found in the coast range of Oregon. Research and suggestions led to entoloma parasiticum as the most likely candidate.

Φωτογραφίες / ήχοι

Παρατηρητής

traceurcameron

Ημερομηνία

Δεκέμβριος 28, 2020 02:15 PM UTC

Φωτογραφίες / ήχοι

Παρατηρητής

terryleecrane

Ημερομηνία

Οκτώβριος 14, 2004 02:30 PM CDT

Φωτογραφίες / ήχοι

Παρατηρητής

dietel

Ημερομηνία

Δεκέμβριος 21, 2021 07:15 PM PST

Περιγραφή

Modified by CombineZP

Φωτογραφίες / ήχοι

Παρατηρητής

glosterbirder

Ημερομηνία

Οκτώβριος 16, 2017 03:26 PM BST

Περιγραφή

Right hand bird in photos with Common Snipe.

Φωτογραφίες / ήχοι

Παρατηρητής

imlichentoday

Ημερομηνία

Δεκέμβριος 7, 2021 07:00 PM PST

Περιγραφή

Low tide. Shot from above and below water.

Φωτογραφίες / ήχοι

Παρατηρητής

theoneje

Ημερομηνία

Ιούλιος 1, 2021 02:44 PM HST

Περιγραφή

oh M. polymorpha

Φωτογραφίες / ήχοι

Παρατηρητής

ctrubo

Ημερομηνία

Δεκέμβριος 2021

Τόπος

United States (Google, OSM)

Περιγραφή

Growing under Quercus agrifolia. Immediate blue bruising of flesh and pores. Cap-light tan (darkening with handling). Pores- light yellow, very small. Stipe- bulbous with narrowing at apex with yellowish top half, brownish bottom half, no reticulation seen. Distinct odor, mildly bitter taste.
Last photo in series shows much larger, older, decomposed fruit body growing within a couple feet away and likely the same species as this observation.