Occuring mostly on significantly decomposed wood. Wood not identified but likely Kunzea leptospermoides as this was the dominant tree host in the area. Also potentially Acacia dealbata.
Potentially P. papuana or something close in section Cordisporae.
Last 3 photos are microscopy.
Spores 6-7.5 μm long - 5.3-5.8 μm wide.
Fotos por Juan Sebastian Alcarcel. Ejemplar conservado en su fungario personal voucher JM3. Última foto propia, cultivo en MEA a partir de esporas. Extraído y secuenciado. Análisis filogenetico (manuscrito en proceso) y MegaBlast=Morchella purpuracens
ITS: TTCCGTAGGGTGAACCTGCGGAAGGATCATTACCAAGAACCACACAGAAAAGGGAGGCAAAGGGGCCTACAGGGCTAGTAGCTTATACGTTGTTGAACGTCCTGCCTGGACCCGGAGCCGCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGGCATCTCGTCGGGGGGAGGTAACAACCAAAACTCTCTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTTGTTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAGACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATAATAGGCTTGCAGTAAAATGCTCACCTCTCTCCACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTTGTGGCCTAGCATCCACCATACATAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCKAGTGAAGCGGCAAAAGCTCAAATTTTAAAGCTGACATCTTCGGTGTCCGCGTTGTAATTTTGTGAGGCATCTCCGGGTAGGGCGCTGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCTTGGCTGGCTGTCCCCGTCCATGTGAGGTGTCTTCGACGA
TEF: waiting for sequences
RPB1: CGTTGGTATATATCCACTCTACTCCATTAAAAGAAACTTTAGGTTTCGCTAACGTTACTTCCCTAGGCTTTCTCAATAAAATCAAAAAGGTTCTCGAGACAGTTTGCTACAACTGTTCAAAGATCAAGTTAGATGAAGTGAGACACACTGAATAAGTGGCGTGGCGTCTTGGCTTTCGTTTGGCTAACAGAAACCTACCTTTCAGTCAAACCCCCAATTTGCCGATGCTTGCAAGATTCGAGAGCCAAAAGCTCGTTTCAACGCTGTATGGCGTTTATGCAAAGCAAAATCCACCTGTGACTCTGACAACACCGCGGGCGACGAAGAGAATAATTTCGGCGATGACGCAGGCACCAACCCGGAGAAGAAGAAGTCCCACGGTGGTTGTGGTAATAAACAGCCTACTATTCGGCGTGAAGGTCTCCGCTTGATCGGAACTTGGAAACCGGACAAGGATGCACAGGAGGAAGCTAGTCAGGGAGAGAAGAAGCCAATTCTTCCCTCGGAAGTTCTCAGTATTTTCAAACACATCACTAGTGATGAGATAAGGAAGATGGGGCTGAGCGAAGATTATGCTCGACCAGAATGGATGGTGATTACGGTTCTACCCGTGCCACCACCACCCGTTCGGCCCAGTATCTGTGTGGATGGTATGGGCGGAGGAATGCGAGGAGAGGACGATTTGACATACAAGCTGGCCGAGATTATCCGAGCAAACGCCAGTGTACGCGATGCTGAACAAAAACGGATCTCCAGCGCACGTCGTCAACGAA
RPB2: CTGTGTAGCCGTTGTACATGACCTCGAAACCACGGCTCTGGTAGCCGTTCTGGCGCAGAAGTGTGGAAACGGACTCGACAGTGACGTCGGTGAACGGTGTAGCGTCGCCCTCAAAACCACGGAGGGAAGAAACCTTCGACAGCTGGCACTCGATCAAATGGGCAATTGTCATACGGGACGGAATAGCGTGGGGATTGATGATAAGATCCGGCACGATACCCTCGCAGGTGAAAGGCATGTCCTCTTGTCTATAGGTGATACCGACGGTACCCTTCTGCCCGTGGCGAGAGGCAAACTTGTCTCCGATCTGAGGGATCTTGGTGGTTCGCATGCGGACCTTGACGAACTTGAGCCCCTCGGCGTTGGTGGTAAGCATAACCTGGTCAACGATACCGTTTTCGGTACTACGGAGGGGCGTGGAGACGTCACGCTTTGTGTGGAACTTTTGCCGCTGACCCATCTCATCGACATCTGGTGCAATAGGCGCCGTCTTTCCAATGATGATATCCTCTCCGGATACACGTACTCCCGGAGCCACAAGACCGTCCTCATCAAGCTTATCATATGTTCCGTGCTTGAGCTTCAACGTGTTGGCACGGGTCGGCTTTTCAAACTCTTCCACAACCTGCATACCAATACGCTTCTCCTGGTCCATGTACGAACGGTAGAACAACGAACGGAAGAGCCCACGATCAATCGATGACTGGTTCATAATGACAGAATCCTCCTGGTTGTACCCTGAGTAACACAAGATGGCGACAATAGCATTCTGCCCGGCCGGCAGCTCTCGAAACTTCAGGTACTCCATAGAACGTGTGGTAGCAAGCGGCTTCTGTGGGTAGT
Growing on the upper end of a large fallen conifer log spanning a stream
3.5 cm tall
Not sure what the microscopic photos show, but I included them
sequenced collections made of this species in this immediate area at this same locality-- lacking ITS data though so I will sequence myself as the institution has not given me that data
West of the burned oak plot at the base of a burned oak seedling/stump sprout.
Right on the edge of the oak forest and grasslands trail side of the oak plots.
Potentially a different species from the “warty” Genea, or possibly just fresher.
Found growing amongst Ponderosa Pine, Douglas and Grand Fir
At base of spruce with lots of hemlock around. Tastes of radish and smells mild to strong. One part got nibbled and the damaged tissue displayed impressive fluorescence under 365nm.
Fruiting beneath Douglas fir.
Elevation: 1900ft.
Harvested/dehydrated specimen for herbarium collection.
My coinciding Mushroomobserver observation below-
Beneath Douglas fir and Ponderosa pine.
Elevation: 1900ft.
My coinciding Mushroomobserver observation below-
Beneath Douglas fir and Ponderosa pine.
Elevation: 1900ft.
Harvested/dehydrated specimen for herbarium collection.
My coinciding Mushroomobserver observation below-
Beneath Ponderosa pine, vine maple and Douglas fir.
Elevation: 1900ft.
Harvested/dehydrated specimen for herbarium collection.
My coinciding Mushroomobserver observation below-
In flowerbed with irises, but near a very large pin oak. Smells mildly cheesy-nutty-mushroomy.
Spores were photographed under a microscope by Chance Brueggeman (cbrueg). He observed mainly 4 spores per asci, some less, and very few with 5. He observed it was dextrinoid in Melzer's Reagent.
In small wet meadow under Pinus ponderosa. Pits brown, irregular but all vertical, veins very dark on outer edges, head forming an apparently sterile lip before the stipe attachment point. Stipe whitish, with wrinkles at the base that become pits or even holes.
.ab1 file located at
https://drive.google.com/drive/folders/1jouC_qj1HCCPsyZjkBi67tQksIQNbJvV?usp=sharing
Growing around wooden sign in irrigated lawn of developed land. Unfortunately a lawn mower or weed whacker apparently decapitated them recently and I was able to only find one older small specimen fully intact. Rhizomorphic growth in soil down to some well decomposed wood that seems to be coniferous. Gills pale but becoming slightly darker in age on a few of the clipped heads I found. Stipe shows blue staining. Gregarious fruiting of ~ 10 stipes
Follow up to this observation http://www.inaturalist.org/observations/179769144
In canyon wall and soil clinging to underside of boulder with roots nearby, presumably belonging to the Quercus chrysolepis uphill. Alder and bay laurel also nearby, alder being downhill near the stream
On soil under bay laurel / live oak. Asci 8-spored.
collected with Rye and Heather Dawson for Fungal Diversity in the Cascade-Siskiyou National Monument
collected with Rye and Heather Dawson for Fungal Diversity in the Cascade-Siskiyou National Monument
collected with Rye and Heather Dawson for Fungal Diversity in the Cascade-Siskiyou National Monument. Same as: https://www.inaturalist.org/observations/168446127
Growing in the same location as observation 454185 and observation 454187. Outside of the Northeast corner of Kottman Hall. Growing abundantly under the soil at the base of a Tilia sp. Quercus rubra nearby. Some ascocarps had been excavated and partially eaten by Sciurus carolinensis. Ascocarps up to 35.7 mm wide. Peridium verrucose. Texture firm. Strong pungent odor, described as being like “broccoli with soy sauce” by P. Brandon Matheny and students. I would agree with this description but add that it had a note of garlic.
—
Originally posted to Mushroom Observer on Apr. 11, 2023.
Additional specimens not added to iNat observation fields:
University of Michigan Herbarium: MICH352021
—
Additional sequences:
ITS: GenBank MZ919157
—
Originally posted to Mushroom Observer on Jun. 3, 2019.
Sequenced by Xi-Hui for a Morchella taxonomy project - Uppsala University/Stockholm University
South of the burned plot at the edge of the oak forest.
6 cm long, in conifer forest, Upper S Fork Skokomish River trail. DNA results matched Gyromitra esculenta.
Growing in indigenous forest under Euclea racemosa. Samples collected and sequenced as M. importuna by B. van der Merwe (Stellenbosch University).
This is a second collection of the day of a species whose spores match G. olympiana but was some distance away from the other collection. Voucher retained
On a rotting old growth Abies magnifica log.
This collection was sent to Dr. Rytas Vilgalys at Duke.
Growing on a moss covered fallen hardwood. Brown/black spore deposit on the stem. Stem darkened to a brown when rubbed. Area is full of beech, oak, hemlock, and rhododendron. Shady and moist. Rocky and mossy. Not a bog.
Unnamed species in subgenus Discina, close to G. olympiana
Under large dead Abies concolor in an area burned by the 2013 rim fire.
Odor spermatic, but lacks the sharp fresh cut grass odor of M. snyderi.
On the ground under Pinus ponderosa and Abies concolor.
Found on the ground, and nearby on conifer wood.
Bosque nuboso
2500 m.s.n.m.
Lugar: Cusco, Estación Biológica Wayqecha
Added a couple images including 2nd nearby specimen cut at base.
Growing singular under salal in fir dominant forest. Near doug fir, western hemlock, big leaf maple and sword fern. Growing from soil, through duff. Flattened ridges turning black/brown w/ maturity. Rounded cap is an infrequent morphology for this species. DNA analyzed in fall of 2020, both ITS and RPB2 regions sequenced.
Type collection (isotype) https://mycoportal.org/...
—
Additional sequences:
ITS: GenBank MK169365. Sequenced under a grant from the Daniel E. Stuntz Memorial Foundation.
—
Originally posted to Mushroom Observer on Jun. 9, 2021.
Mixed conifer forest (mostly douglas fir with mixed in ponderosa and grand fir) with some vine maple/ hazelnut under story.
Small fruit bodies
Or similar, stem has a granular texture in larger and more mature specimens. I'll keep ascocarp tissue for DNA/microscopy.
Collected by Mike Dechter.
Growing from seeps in drainage at about 2100 m. Mixed conifers.
DNA sequenced
Substrate: old Populus trichocarpa log.
Reference: Koukol, Ondřej. (2016). Myriococcum revisited: a revision of an overlooked fungal genus. Plant Systematics and Evolution. 302. 10.1007/s00606-016-1310-x.