Σεπτέμβριος 14, 2021

COI 266bps / Freshwater Clam / South Korea

COI 266bps / Freshwater Clam / South Korea..

https://pintail1.ivyro.net/04homepage/kongju/pintail/2021/09_September/20210919.htm



Sinanodonta schrenkii 200522 IS01

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenkii 200225 21

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAAAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenkii 200225 20

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCATTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGGTGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTCGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta schrenckii Blue13

GGAAATTGACTTATTCCTTTAATAATTGGAGCTCCTGATATAGCTTTTCCTCGGTTAAATAATTTAAGATTTTGGTTACTTGTACCAGCACTATTTTTGCTCTTAAGGTCTTCTTTGGTAGAGAGGGGTGTTGGAACAGGATGGACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGTGCTTCTGTAGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCTATTCTAGGCGCTATTAATTTTATTTCTAC

Sinanodonta lauta Sep 18

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Sep 05

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue6

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue50

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue33

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGTGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta Blue23

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTAAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta AS01

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGAACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGAGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 2019 02

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTGTTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCGATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 2019

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 200225 43

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTACGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 200225 31

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGGGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta lauta 1

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCCTTTCCTCGGTTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGTTGTTTTTATTATTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACAGGGTGAACAGTATATCCACCTTTATCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATCTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCGTCTATTTTAGGTGCTATTAACTTTATTTCTAC

Sinanodonta cf woodiana 2 Blue40

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC

Sinanodonta cf woodiana 2 200225 39

GGGAATTGATTAATTCCTTTAATAATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTGCCAGCGCTATTTTTATTATTAAGGTCTTCTTTGGTGGAAAGGGGCGTTGGTACAGGGTGAACAGTATACCCACCTTTGTCTGGGAATGTTGCTCATTCTGGCGCTTCTGTTGATTTAGCTATTTTTTCTTTGCACCTTGCCGGTGCTTCATCTATTTTAGGCGCTGTTAATTTTATTTCTAC

Nodularia douglasiae sk03

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae LUS02

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae JN01

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCAGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae CH01

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae Blue17

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATCTTTTCACTCCATCTGGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 210729 70

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 210729 154

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGNTAATGTTGCTCATTCTGGAGCTTCTGTANATTTANCTATCTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 2019

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 200225 BYND2

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCTTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTATTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGAACGGTGTATCCTCCTTTATCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTAGCTATTTTTTCACTCCATCTTGCAGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia douglasiae 200225 ADND3

GGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGGTTACTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCGTCTTTAGTGGAGAGTGGTGTTGGTACCGGTTGGACGGTGTATCCTCCTTTGTCGGGTAATGTTGCTCATTCTGGAGCTTCTGTAGATTTGGCTATCTTTTCACTCCATCTTGCGGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Nodularia breviconcha KJ02

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGAGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha HC02

GGGAATTGACTTATTCCCTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue43

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue35

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha Blue32

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha Blue18

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 210729 71

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 2020 BS07

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCATTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 200522 YS04

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 200522 YS03

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCGGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAATTTCATTTCTAC

Nodularia breviconcha 200522 JH06

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTATTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCAGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

Nodularia breviconcha 200522 JH05

GGGAATTGACTTATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGTTTAAACAATTTAAGGTTTTGGTTGCTTGTTCCTGCTTTGTTTTTGTTATTAAGGTCATCTTTAGTAGAAAGCGGTGTTGGTACTGGTTGAACGGTGTATCCGCCTTTATCCGGTAATGTTGCTCACTCTGGGGCTTCCGTAGATTTGGCTATTTTTTCACTTCATCTTGCGGGTGCCTCTTCTATTTTGGGTGCTATTAACTTCATTTCTAC

NCBI MT020521.1 Aculamprotula coreana

GGTAATTGGTTAATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTCCCTCGTTTAAATAATTTGAGGTTTTGGCTACTTGTTCCAGCTTTATTTTTGTTGTTGAGATCATCTTTAGTGGAAAGGGGTGTAGGCACTGGGTGGACAGTGTATCCGCCTTTAGCAGGAAATGTTGCTCATTCTGGAGCTTCGGTAGATTTGGCTATTTTTTCTTTACACTTAGCCGGTGCTTCGTCTATTTTGGGGGCTATTAATTTTATCTCTAC

NCBI DQ264395.1 Limnoperna fortunei

GGGAATTGGTTGATTCCATTAATAATAGGGGCAGTAGATTTGATTTTTCCACGATTGAATAATATAAGGTACTGRTTTCTTTTTTTTTCCTTAGGACTTTTTTTATTGTCTATGCATGTAGAGGGTGGAGTAGGGACTGGTTGGACAGTTTATCCTCCTTTATCTAGTTTTGATGCTCATAGAACCCCAGCAGTTGACATAGCTGCTTTATCTCTTCATTTAGCTGGTGCGTCGTCAATTGGCGGTTCGTTAAATTATATTACTAG

Lanceolaria sp MK02

GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCGTCAATTTTAGGTGCTATTAATTTTATCTCTAC

Lanceolaria sp MK01

GGGAATTGGCTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGGCTGAATAACTTAAGATTTTGGCTGCTTGTGCCGGCTTTGTTTTTGTTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGAACAGTGTATCCTCCTTTGTCAGGGAATGTTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCTTCATCAATCTTAGGTGCTATTAATTTTATCTCTAC

Lanceolaria acrorrhyncha 2019

GGAAATTGACTTATTCCTCTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGCCTAAATAATTTAAGGTTTTGGCTGCTTGTGCCGGCTTTGTTTTTACTTTTAAGGTCGTCTTTGGTGGAAAGAGGTGTTGGTACTGGTTGAACTATGTATCCCCCTTTGTCAAGAAATGCTGCTCATTCTGGGGCTTCAGTGGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATTTTATCTCTAC

Lamprotula seomjinensis 210729 152

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGACATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTGTTAAGATCTTCGTTGGTAGAGAGAGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCACTCCGGGGCTTCGGTAGACTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Lamprotula leaii 2020 BS06

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 210729 65

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 210729 64

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCGTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGCGCTATTAATTTTATTTCTAC

Koreosolenaia sitgyensis 2020 BS02

GGAAATTGGCTTATTCCACTTATGGTTGGGGCACCTGATATGGCTTTTCCTCGGCTAAATAACTTAAGGTTTTGGTTACTTGTGCCGGCTCTTTTTTTACTATTAAGGTCTTCTTTGGTTGAGAGAGGTGTTGGGACAGGGTGGACTGTTTATCCCCCATTATCTGGGAATGTTGCCCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCATTGCATCTTGCGGGTGCTTCCTCTATTTTAGGTGCTATTAATTTTATTTCTAC

KOREA EU090399.1 Corbicula sp.

GGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

KOREA EU090397.1 Corbicula sp.

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCAC

KOREA AF457992.1 Corbicula sp.

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

Inversiunio verrucisus 2020 BS04

GGTAATTGACTTATTCCTCTGATAATTGGTGCTCCTGATATGGCTTTTCCACGATTAAACAATTTGAGTTTTTGGTTGCTTGTCCCAGCCTTGTTTTTGTTGTTAAGTTCGTCTTTGGTAGAGAGGGGTGTTGGTACTGGTTGAACAGTATATCCACCTTTGTCTGGAAATGTTGCTCATTCTGGGGCTTCAGTGGATTTGGCTATTTTTTCATTACATCTTGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC

HYTr Musculium lacustre

GGAAATTGATTGGTACCATTAATATTANTGGTTCCTGATATAGCTTTTCCTCGTTTAAATAACTTAAGATTTTGGTTATTACCTGTTGCATTATTGTTATTGTTAGGATCAGCTTATGTAGAGAGAGGAGCTGGAACTGGGTGAACTATCTATCCCCCATTGTCTGGAAATGTAGCTCATGCTGGACCTTCAATANAATTTGCAATTTTGTCTTTACATTTAGGTGGTGCTTCATCTATTGCTGCATCAATTAATTTTTTAACTAC

Cristaria plicata 2019

GGGAATTGACTTATTCCACTAATAATTGGTGCTCCCGATATGGCTTTTCCTCGCCTAAATAACCTGAGGTTTTGATTACTTGTACCGGCATTGTTTTTACTATTAAGATCGTCTTTGGTAGAAAGAGGTGTTGGTACTGGTTGGACGGTATATCCGCCCTTATCCGGAAATGTTGCTCACTCTGGGGCTTCTGTAGATTTGGCTATTTTCTCTTTACACCTTGCTGGTGCTTCATCAATTTTGGGTGCCATTAATTTTATTTCTAC

Buldowskia shadini us23

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini Blue31

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini Blue28

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 fatSeosan2

GGAAACTGACTTATTCCTTTAATAATTGGGGCTCCCGATATGGCCTTTCCGCGATTGAATAACCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 55

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia shadini 200225 40

GGAAACTGACTTATTCCTTTAATAATTGGTGCTCCCGATATGGCCTTTCCGCGATTGAATAATCTAAGGTTTTGGTTACTCGTGCCGGCTCTGTTTCTATTATTAAGATCTTCGCTAGTGGAGAGTGGTGTAGGTACTGGTTGGACAGTTTACCCTCCACTATCTGGGAACGTAGCCCATTCTGGAGCTTCTGTGGATTTGGCGATTTTTTCACTACATTTGGCTGGAGCTTCCTCAATTCTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 SC01

GGAAATTGACTCCTTCCTTTGATGATTGGCCCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCAGATTGCTCGTGCCCTCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAAGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCGTCTGGCTGGGGCTTCCTCAATTTTATGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 KR02

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 2020 KR01

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 200225 58

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia iwakawai 200225 18

GGAAATTGACTCATTCCTTTGATGATTGGCGCCCCTGATATGGCTTTTCCGCGGTTGAATAATTTAAGGTTCTGATTGCTCGTGCCAGCCTTGTTTCTATTATTAAGGTCTTCATTAGTGGAGAGAGGTGTAGGAACTGGTTGGACAGTTTATCCCCCTTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCACTTCATCTGGCTGGGGCTTCCTCAATTTTAGGTGCTATTAATTTTATTTCTAC

Buldowskia flavotincta SK06

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGGCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGGAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTATCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta sk02

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta SK01

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCCCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

Buldowskia flavotincta Buyeo 01

GGGAACTGACTCATTCCTTTGATGATCGGTGCCCCTGATATAGCTTTCCCGCGGTTGAATAATTTAAGATTCTGATTGCTTGTGCCGGCTCTGTTTCTTTTATTAAGATCTTCGTTAGTGGAGAGAGGCGTAGGTACTGGTTGGACGGTTTATCCCCCCTTGTCTGGGAACGTAGCTCATTCTGGGGCTTCTGTGGATTTGGCCATTTTCTCATTACACTTGGCCGGGGCTTCTTCAATTTTAGGCGCTATTAACTTTATTTCCAC

BSPc01 Potamocorbula amurensis

GGTAATTGATTAGTTCCTTTGATGTTAGCTGTTCCAGATATGGCGTTTGCTCGTATAAATAATTTAAGATTTTGAGTTCTTCCTTCTTCTTTTACATTAATGGGCTTTTCTCTTTTTAGTGAAGGTGGTTTTGGTGGTGGGTGAACTCTTTACCCTCCTTTATCTAGAAATATTGCTCATTCTGGTCCAGCTATAGATTTTTTAATTTTGTCTCTTCATTTAGGGGGTTTGTCGTCAATTATGGCTTCTTTGAACTTTTATAGGAC

Anemina euscaphys Black15

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC

Anemina euscaphys Black14

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGGGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATGTTAGGAGCTATTAATTTCATTTCTAC

Anemina euscaphys Black12

GGGAATTGGCTTATTCCTTTAATGATAGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACCGTTTATCCTCCTCTGTCCGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGAGCTATTAATTTTATTTCTAC

Anemina euscaphys 2020 MY01

GGGAATTGGCTTATTCCTTTAATGATTGGCGCCCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTCTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATCTTAGGAGCTATTAATTTTATTTCTAC

Anemina arcaeformis Sep 26

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Blue10

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTAGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGGTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTCCATTTGGCTGGGGCTTCTTCGATTTTAGGGGCTATTAATTTTATTTCTAC

Anemina arcaeformis Black6

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Black13

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis Asan03

GGGAATTGGCTTATCCCTTTAATGATTGGCGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTGGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCGATTTTAGGTGCTATTAATTTTATTTCTAC

Anemina arcaeformis 200522 AD21

GGGAATTGGCTTATTCCTCTTATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAACAATTTAAGATTTTGGTTGCTTGTGCCAGCGCTGTTTTTATTATTAAGATCTTCATTAGTGGAGAGAGGTGTGGGAACCGGTTGAACTGTTTATCCTCCTTTGTCTGGAAATACGGCTCATTCTGGAGCATCAGTGGATTTGGCTATTTTTTCTTTGCATTTGGCTGGTGCTTCTTCTATTTTAGGTGCTATTAATTTTATTTCTAC

Aculamprotula sp JJ01

GGTAATTGGTTGATTCCTATGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGGTGGAACTGGATGAACGATGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATGTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

Aculamprotula sp 210729 69

GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

Aculamprotula sp 210729 66

GGTAATTGGTTGATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGTTTGAATAATTTAAGGTTTTGATTGCTTGTGCCGGCTTTGTTTTTATTATTGAGGTCTTCCTTAGTAGAGAGGGGTGTTGGAACTGGCTGAACGGTGTACCCCCCTTTATCTGGAAATATTGCTCATTCTGGGGCTTCTGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCTATTTTGGGGGCTATTAATTTTATTTCTAC

2021 SSCo01 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 Pisidium coreanum

GGAAATTGGNTANTTCCNTTGATGTTGGTTGTTCCTGATATGGCTTTTCCTCGTTTAAATAATTTAAGGTTTTGATTGTTACCTGTTGCATTAATGTTATTATTAGGTTCTGCTTACGTTGAAAGAGGTGCTGGAACTGGTTGAACTATTTATCCNCCGTTGTCTGGGAATGTTGCTCAGGCTGGCCCTTCTNTANAGTTTGCTATTTTGTCTTTACATTTGGGTGGNGCTTCTTCTATTGCTGCATCTTTNAATTTTTTGACTAC

2021 KJH Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH Asan15 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH 0808 86 Corbicula felnouilliana

GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJH 0729 75 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 KJCo01 Corbicula fluminea

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 JJCo01 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 HDCo03 Corbicula japonica

GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 HDCo01 Corbicula felnouilliana

GGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 BSCo04 Corbicula leana

GGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCAC

2021 BSCo01 Corbicula japonica

GGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTAC

2021 08 08 151

GGGAATTGGCTTATTCCACTAATGATTGGGGCTCCTGATATGGCTTTTCCGCGGTTAAATAATTTGAGGTTTTGGTTGCTTGTTCCGGCTCTTTTTTTATTATTAAGGTCTTCGTTGGTAGAGAGCGGTGTGGGGACTGGGTGGACGGTTTATCCGCCCTTGTCTGGGAATGTTGCTCATTCTGGGGCTTCAGTAGATTTGGCTATTTTTTCGTTACATTTGGCTGGTGCTTCTTCTATTTTGGGTGCTATTAATTTTATTTCTAC



Αναρτήθηκε στις Σεπτέμβριος 14, 2021 0652 ΠΜ από pintail pintail | 2 παρατηρήσεις | 0σχόλια | Αφήστε ένα σχόλιο

Σεπτέμβριος 03, 2021

Corbicula's COI on South Korea

I compared the COI gene in the mitochondria of Genus Corbicula with KIM, Jae-hoon and SUNG, Soo-min. Found 4 species this time in South Korea. The four species were Corbicula leana, Corbicula fluminea, Corbicula japonica, and Corbicula felnouilliana.

Please visit the page below to see their photos.
https://cafe.naver.com/yangpakor/40624
https://cafe.naver.com/yangpakor/40625

2021 BSCo01 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo02 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 BSCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 BSCo04 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 HDCo01 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HDCo03 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAAAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 HSCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 JJCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 JJCo03 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0729 75 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTANCTGGGGCTC
2021 KJH 0808 84 Moongyeng Corbicula fluminea papyracea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH 0808 86 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 92 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH 0808 93 Corbicula felnouilliana
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATAATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAAATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
2021 KJH Asan15 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAAATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 KJH Youngam Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo01 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 MGCo03 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 MKCo02 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAAATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTANCTNTTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 NSCo02 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC
2021 SJCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
2021 SSCo01 Corbicula leana
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATGGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
AY097287.1 Corbicula fluminalis
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGCCTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAGCTAATCCGGCCTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTGGCAGGGGCTC
JAPAN AY097314.1 Corbicula japonica
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTCTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA AF457992.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGGTCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090396.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090397.1 Corbicula sp.
TTTTAGGGTAATTATTCGAATGGAGCTTGCTATTCCAGGGACTTTACTAGATGATGGGCAGTTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTAATGCCAATAATGATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGATTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTAGTTAGATCGGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCGTCAGTAAATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCGATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCGCAAAAGCTAATTCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTGTTAGCTGGGGCTC
KOREA EU090398.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTTACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGACTTTTGCCTATGGCTATGCTTTTGTTGGTGAGATCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCCCCTCTTTCTAGCAATATTGCTCATTCTGGTCCTTCGGTAGATTTAGCTATTTTTTCTCTTCATTTAGGGGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGATTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KOREA EU090399.1 Corbicula sp.
TTTTAGAGTAATTATTCGAATGGAGTTAGCTATTCCAGGGACTTTATTGGATGATGGTCAATTATATAATACTATTGTCACTGCTCATGCTTTAGTAATGATTTTTTTTTTAGTAATGCCTATGATAATGGGCGGTTTTGGAAATTGGCTTGTTCCTTTAATGTTAAGAGCTCCTGATATGGCTTTTCCTCGACTAAATAATTTAAGGTTTTGACTTTTACCTATGGCTATGCTTTTGTTGGTGAGGTCAGCTTATGTTGAAAGTGGAGCTGGGACTGGTTGAACTGTTTATCCTCCTCTTTCTAGAAATATTGCTCATTCTGGTCCTTCGGTAGATTTGGCTATTTTTTCTCTTCATTTAGGAGGTATTTCTTCTATTTTGGCTTCAATTAATTTTGTTGTTACTAGGTTTTGTATGCGTCCTGGAGCACAAAAATTAATTCGGACTACAATGTTTATTTGGTGTATTGTAGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGAGCTC
KX192336.1 Corbicula fluminea
TTTTAGGGTAGTTATTCGAATGGAGCTTGCTATTCCAGGGACTTTATTAGATGATGGGCAGCTGTATAATACTATTGTTACTGCTCATGCTTTAGTAATAATTTTTTTTTTAGTGATGCCAATAATAATGGGTGGTTTTGGAAATTGACTTGTTCCATTAATGTTAAGGGCTCCTGATATAGCTTTTCCACGGTTAAATAATTTAAGATTTTGGCTTTTACCTATAGCTATGCTTTTGTTGGTTAGATCAGCTTATGTTGAGAGTGGTGCTGGGACTGGGTGGACTGTTTATCCTCCTCTCTCTAGAAATATTGCTCATTCTGGCCCGTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGGGGGTATTTCTTCAATTTTAGCTTCAATTAATTTTGTTGTCACTAGATTTTGTATGCGTCCTGGAGCTCAAAAACTAATCCGGACTACAATGTTTATTTGATGTATTGTTGTAACTGGAATTTTGTTGATTATTGCAATGCCTGTATTAGCTGGGGCTC

Αναρτήθηκε στις Σεπτέμβριος 03, 2021 1058 ΠΜ από pintail pintail | 0σχόλια | Αφήστε ένα σχόλιο

Δεκέμβριος 06, 2019

Sinanodonta woodiana, Anemica arcaeformis in South Korea

It was believed that Sinanodonta woodiana and Anemica arcaeformis lived in the surrounding rice fields. Anemica arcaeformis thought to be fatter than Sinanodonta woodiana.

https://cafe.naver.com/yangpakor/1999

However, recent comparisons of mtDNA show that they are all one species. And what's more confusing is not exactly what species it is.

In Korea, China, and Japan, the species Sinanodonta woodiana and Anemica arcaeformis appear to be completely different. Yes, when you look at the data on the NCBI.

https://cafe.naver.com/yangpakor/35942

Clearance of these two species is needed and research requires a record of the new species.

Αναρτήθηκε στις Δεκέμβριος 06, 2019 1051 ΠΜ από pintail pintail | 0σχόλια | Αφήστε ένα σχόλιο

Νοέμβριος 19, 2018

Research on the Rana of the Korean Peninsula is very much needed.

There are three species in our country.
Rana coreana is small and easily distinguishable. However, Rana uenoi and Rana huanrenensis were recorded as similar species.

Rana uenoi lives in Jeema Island from Jeju Island to the Korean peninsula.
Rana huanrenensis inhabits the peninsula in Chinese huanren and is smaller than Rana uenoi.

These two species have been recorded in numerous scientific names since the 1930s, sometimes as a species.

Rana uenoi is still recorded as Rana dybowskii. Rana uenoi and Rana dybowskii are likely to live in North Korea. Rana dybowskii is most likely to live in northern North Korea. Rana huenrensis and smaller Rana chensinensis in North Korea

Research on the Rana of the Korean Peninsula is very much needed.

https://cafe.naver.com/yangpakor/33529
https://repository.kulib.kyoto-u.ac.jp/dspace/bitstream/2433/216901/1/zs140080.pdf
http://www.jonjfong.com/Website/Publications_files/Mol.%20Phylogenet.%20Evol.%202017%20Yang.pdf

Αναρτήθηκε στις Νοέμβριος 19, 2018 0210 ΜΜ από pintail pintail | 0σχόλια | Αφήστε ένα σχόλιο

Νοέμβριος 18, 2018

In 2018, about a quarter of the population is likely to be compared to 2008.

It is impossible to compare amphibian populations.
However, we tried to compare the population in 2008 and 2010.
We investigated the number of the same place Rana uenoi in the same place.

I feel right.
Certainly ... The population of Rana uenoi seems to be declining ...

I have done similar research in the same time period in 2016 in San Sali ....

https://cafe.naver.com/yangpakor/30240

There is not much difference from the result now.

In 2018, about a quarter of the population is likely to be compared to 2008.
In Seosan, Chungnam Province.

https://cafe.naver.com/yangpakor/33521

Αναρτήθηκε στις Νοέμβριος 18, 2018 1016 ΠΜ από pintail pintail | 1 παρατήρηση | 0σχόλια | Αφήστε ένα σχόλιο

Νοέμβριος 17, 2018

What is the distribution of Rana dybowskii and Rana uenoi? North Korea has the answer.

What is the distribution of Rana dybowskii and Rana uenoi? North Korea has the answer.

https://cafe.naver.com/yangpakor/33443

The distribution of Rana dybowskii, Rana uenoi and Rana huanrensis recorded in the inaturalist, Rana huanrenensis seems to be distributed from China to Korea including North Korea. It is expected that Rana uenoi will spread from Tsushima, Jeju Island, Japan, South Korea to the central and southern regions of North Korea. Rana dybowskii is probably not expected to extend to the northern part of North Korea, and it is worth investigating how Baekdu Mountain forms the boundary.

https://www.inaturalist.org/journal/pintail/5235-south-korea-rana-uenoi-rana-huanrensis-rana-coreana
https://cafe.naver.com/yangpakor/32192

In the above two articles, we are talking about the distribution of Rana dybowskii and Rana uenoi.
What effect did Paekdusan have on the distribution of Rana dybowskii?

Αναρτήθηκε στις Νοέμβριος 17, 2018 0102 ΜΜ από pintail pintail | 0σχόλια | Αφήστε ένα σχόλιο

Απρίλιος 24, 2018

It seems that Gloydius Tsushimaensis lives not only in Japan Tsushima but also in Jeju and southern parts of Korea.

It seems that Gloydius Tsushimaensis lives not only in Japan Tsushima but also in Jeju and southern parts of Korea.

MtDNA of individuals collected in Jeju and Sacheon in Korea were similar to those of Gloydius tsushimaensis in NCBI.

I think there is a possibility that it is widely distributed in South Jeolla Province and South Gyeongsang Province which are southern part of Korea.

http://cafe.naver.com/yangpakor/32397

Αναρτήθηκε στις Απρίλιος 24, 2018 0302 ΠΜ από pintail pintail | 2σχόλια | Αφήστε ένα σχόλιο

Απρίλιος 01, 2018

Hynobius's distribution

It publishes the distribution of eight species of Hynobius salamander in South Korea.
I can't paste the picture file, so I upload the link I've posted.
http://cafe.naver.com/yangpakor/32285

Αναρτήθηκε στις Απρίλιος 01, 2018 1248 ΜΜ από pintail pintail | 1 παρατήρηση | 0σχόλια | Αφήστε ένα σχόλιο

Hynobius of South Korea

Hynobius, a South Korean habitat, is not easy to distinguish species by their outer form. You may be able to see the teeth of the palate by dissection, but salamanders die.
The best way is to analyze the mitochondrial DNA. Currently, four species have Korean names and the other four have not yet been named. HC1, HC3 was first released in 2008 by Baek Hye-jun. Below are the eight Hynobius Salamander DNA sequences.

hynobius_leechii
GCCGGGATAGTGGGCACCGCCTTAAGTCTCTTAATTCGAGCTGAGTTAAGCCAACCCGGGACTCTTCTT
GGAGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACC
AGTAATAATTGGGGGTTTTGGAAATTGACTAGTTCCATTAATAATCGGCGCCCCGGATATAGCATTTCCA
CGAATAAATAATATAAGTTTTTGGTTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
GGCCGGAGCAGGGACAGGCTGAACCGTTTATCCACCATTAGCGGGTAACTTAGCACATGCCGGGGCTT
CGGTTGATTTAACAATTTTTTCGCTACATTTAGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATT
ACAACTTCCATTAATATAAAACCCTCGTCGATATCGCAGTATCAAACACCCTTATTTGTATGATCTGTGTT
AATTACTGCTATTCTTCTTTTACTATCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTAACAGACC
GAAACCTAAACACTACATTCTTCGACCCTGCGGGGGGAGGTGACCCTGTTCTTTACCAGCACTTGTTTT
GATTTTTTGGTCATCCAGAGGTTTAT

Hynobius_yangiI
GCCGGAATAGTGGGTACCGCCCTAAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGAACTCTCCTT
GGGGATGACCAGATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACC
AGTAATAATTGGGGGCTTCGGAAATTGGTTGGTGCCATTAATAATCGGCGCCCCAGATATAGCATTTCCG
CGAATAAATAATATAAGTTTTTGACTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
GGCCGGAGCAGGAACAGGCTGGACCGTCTATCCACCATTAGCAAGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTTTCACTGCATTTAGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATC
ACAACTTCCATTAATATAAAACCCTCCTCAATATCACAATACCAAACACCCTTATTTGTCTGATCTGTATT
AATTACTGCTATTCTTCTTTTATTATCTTTACCAGTCCTTGCTGCAGGGATCACAATACTTCTAACAGACC
GAAACCTAAACACTACATTCTTCGACCCCGCAGGTGGAGGTGACCCTGTTCTCTACCAACACTTATTTT
GATTTTTTGGTCACCCAGAGGTTTAT

Hynobius_quelpaertensis
GCTGGGATAGTTGGCACTGCCTTAAGTCTCCTAATTCGAGCCGAACTAAGCCAGCCTGGGACTCTTCTC
GGGGATGACCAGATTTATAATGTGATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATGGTAATGCC
AGTGATAATCGGGGGCTTCGGAAATTGGTTAGTCCCATTAATAATCGGCGCCCCGGACATAGCATTTCC
ACGAATAAATAACATAAGTTTTTGGCTATTACCCCCGTCATTTCTTTTATTACTAGCATCATCTGGGGTTG
AAGCTGGAGCAGGAACAGGCTGAACCGTTTATCCCCCACTAGCAGGTAACTTAGCACATGCTGGAGCT
TCAGTTGATTTAACAATTTTTTCACTACACTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTAT
TACAACCTCCATTAATATAAAACCCCTATCAATATCCCAATATCAAACACCTTTATTTGTTTGATCCGTATT
AATTACTGCTATTCTTCTTTTATTATCTTTACCAGTCCTTGCCGCAGGAATCACAATACTCCTAACAGACC
GAAACCTAAATACTACATTCTTCGACCCTGCAGGAGGAGGTGATCCCGTTCTCTATCAACATTTATTTTG
ATTTTTTGGTCACCCAGAGGTCTAT

HC1
GCTGGGATAGTGGGCACTGCCCTAAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGAACTCTTCTC
GGAGATGACCAAATTTATAATGTAATTGTAACTGCTCACGCATTCGTAATAATTTTTTTTATAGTAATGCC
AGTAATAATTGGAGGTTTTGGAAATTGGTTGGTTCCATTAATAATTGGTGCCCCAGACATAGCATTCCCG
CGAATAAATAACATAAGTTTTTGGCTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
AGCCGGAGCAGGAACAGGCTGAACCGTTTACCCCCCACTGGCAGGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTCTCACTACACTTAGCAGGTATTTCATCAATTTTAGGAGCAATTAATTTTATT
ACAACCTCTATTAATATAAAACCCTTGTCAATATCGCAATACCAAACACCTTTATTTGTTTGATCAGTACT
AATCACTGCTATTCTTCTTTTACTGTCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTGACAGAC
CGAAACCTAAATACTACATTCTTCGACCCAGCGGGGGGAGGTGATCCTGTTCTCTATCAACACTTGTTT
TGATTTTTTGGTCACCCAGAGGTCTAT

Hynobius_unisacculus_HC2
GCCGGAATGGTGGGCACTGCCTTGAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGATCTCTTCTC
GGTGATGACCAAATTTATAATGTAATTGTAACTGCTCACGCATTCGTAATAATTTTTTTTATGGTAATACC
AGTAATAATTGGGGGTTTCGGAAATTGATTAGTTCCATTAATAATTGGTGCCCCGGACATAGCATTTCCC
CGAATAAATAATATAAGTTTTTGGCTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
AGCTGGAGCAGGAACAGGCTGAACCGTTTACCCCCCACTGGCAGGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAATTTTATT
ACAACCTCCATTAATATAAAACCCCTGTCAATATCGCAGTACCAGACACCTCTGTTTGTTTGATCAGTATT
AATTACTGCTATTCTTCTTTTACTATCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTAACAGACC
GAAACCTAAATACTACATTCTTCGACCCGGCGGGGGGAGGTGACCCTGTTCTCTATCAACATTTATTTTG
ATTTTTTGGCCACCCTGAGGTTTAT

HC3
GCCGGGATAGTGGGCACCGCCCTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGAACCCTTCTT
GGGGATGATCAAATTTATAACGTAATTGTGACCGCCCACGCATTTGTGATAATCTTTTTTATAGTAATACC
AGTAATAATTGGAGGCTTCGGGAATTGGTTAGTTCCATTAATAATTGGCGCCCCAGATATAGCATTTCCA
CGAATAAACAATATAAGTTTTTGACTATTACCCCCATCATTTCTCTTATTACTAGCATCATCCGGGGTTGA
AGCTGGGGCGGGAACAGGCTGAACCGTTTATCCGCCCCTGGCAGGTAATTTAGCACATGCCGGAGCCT
CAGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCGTCAATTCTAGGGGCAATTAACTTTATT
ACAACTTCCATTAATATAAAACCCTCATCAATATCGCAATATCAAACACCCTTATTTGTTTGATCTGTATT
AATTACTGCTATCCTTCTTTTACTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GAAACCTAAATACTACCTTCTTCGACCCCGCAGGGGGAGGCGACCCCGTTCTCTACCAACACCTATTTT
GATTTTTTGGTCACCCAGAGGTTTAT

HC4_Changwon
GCCGGAATAGTGGGCACTGCCCTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACCCTCCTC
GGTGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACCA
GTAATAATTGGGGGTTTCGGAAATTGGTTAGTTCCGTTAATAATTGGCGCCCCAGATATGGCATTTCCAC
GAATAAATAATATAAGTTTCTGATTATTACCCCCATCATTTCTTTTACTATTAGCATCATCCGGAGTTGAG
GCTGGAGCAGGAACAGGCTGAACCGTTTACCCACCACTAGCGGGTAACTTGGCACATGCCGGAGCCT
CGGTTGATTTAACAATTTTTTCGTTGCATTTAGCAGGTATCTCATCAATTCTAGGAGCAATTAACTTCATC
ACAACCTCCATTAACATAAAACCCTCATCAATATCGCAATATCAAACACCCTTATTTGTCTGATCTGTACT
AATTACTGCTATCCTTCTTTTACTGTCTTTACCAGTTCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GGAACCTAAATACCACATTCTTCGACCCTGCAGGGGGAGGTGACCCTGTTCTCTACCAACACTTGTTTT
GATTTTTTGGCCACCCAGAGGTTTAT

HC5_BoSung
AGCTGGATAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCAAATTTATAATGTAATTATAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACA
AGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCC
GCGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTG
AAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGC
CTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTA
TTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTAT
TAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGAC
CGAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTT
TGATTTTTTGGTCACCCTGAAGTTTAA

HC5_YoungAm
CCCTGGATAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCACATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATATTTTTTTTTATAGTAATACCA
GTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCCG
CGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTGA
AGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGCC
TCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTAT
TACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTATT
AATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTTT
GATTTTTTGGTCACCCTGAAGTTTAA

HC5_GoHeung
CGCTGGAAAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACC
AGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCC
GCGAATGAATAACATACGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTG
AAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGC
CTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTA
TTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTAT
TAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGAC
CGAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTT
TGATTTTTTGGTCACCCTGAAGTTTAA

Αναρτήθηκε στις Απρίλιος 01, 2018 1238 ΜΜ από pintail pintail | 0σχόλια | Αφήστε ένα σχόλιο

Μάρτιος 19, 2018

Rana kukunoris and Rana chensinensis 2....

http://cafe.naver.com/yangpakor/32180

Interesting.
Chinese scholars will have an answer in the next 2-3 years.

Rana chensinensis and Rana kukunoris seem to be the final challenge of Rana frogs living in Northeast Asia.

There are three cases below.

The present situation seems to be the situation of (A)
I wonder if (B) is the answer
Or, as in (C), there may be a case of subdividing the species.

What do you think?

In the northern part of North Korea, Rana dybowskii, Rana chensinensis and Rana kukunoris are also likely to live.
All three species of Chinese Yanbian around the Yalu River, including Rana amurensis.

http://cafe.naver.com/yangpakor/32180

Αναρτήθηκε στις Μάρτιος 19, 2018 0314 ΠΜ από pintail pintail | 0σχόλια | Αφήστε ένα σχόλιο