Φωτογραφίες / ήχοι

Παρατηρητής

robertweeden

Ημερομηνία

Ιούλιος 26, 2021 01:30 PM AKDT

Περιγραφή

Found at 745 m elevation in moist area surrounded by dry alpine tundra. I believe the host to be Salix phlebophylla, although I am not that versed in differentiating the willows.

Maybe you can help with this one, Matt... @mbowser

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Σεπτέμβριος 22, 2021 01:29 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

muir

Ημερομηνία

Ιούλιος 18, 2021 09:06 PM AKDT

Τόπος

Kenai, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

jmrobertia

Ημερομηνία

Ιούνιος 14, 2021 04:38 PM AKDT

Περιγραφή

Under one of the signs.

Φωτογραφίες / ήχοι

Παρατηρητής

jdanner

Ημερομηνία

Ιούλιος 2, 2021 11:57 AM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

jdanner

Ημερομηνία

Ιούλιος 2021

Φωτογραφίες / ήχοι

Παρατηρητής

jmorton

Ημερομηνία

Ιούνιος 23, 2017 07:50 PM PDT

Φωτογραφίες / ήχοι

Παρατηρητής

jmrobertia

Ημερομηνία

Ιούνιος 8, 2021 11:40 AM AKDT

Περιγραφή

Living under the rock at the base of the trail sign at the fork in trail. Have seen this species occasionally on this trail for a few years now, but never managed to get one to hold still enough for a photo. The 55-degree weather had this one moving slow.

Φωτογραφίες / ήχοι

Παρατηρητής

jmrobertia

Ημερομηνία

Μάιος 11, 2021 01:33 PM AKDT

Τόπος

Cohoe, AK, USA (Google, OSM)

Περιγραφή

Found this one within 3 feet of where I found what I believe is this same species last summer. it can be viewed here https://www.inaturalist.org/observations/53692487

Φωτογραφίες / ήχοι

Παρατηρητής

drbowser

Ημερομηνία

Απρίλιος 12, 2021 11:07 AM EDT

Φωτογραφίες / ήχοι

Παρατηρητής

alandqz

Ημερομηνία

Μάρτιος 20, 2021 01:25 PM PDT

Περιγραφή

Scales present on scapus and pedicellus of antenna, but not on flagellum, making it Petrobiinae. Compound eyes wider than long (deep), ocelli without obvious constriction, and environment (around upper limit of intertidal zone) indicate the species Neomachilis halophila.

Φωτογραφίες / ήχοι

Παρατηρητής

drbowser

Ημερομηνία

Μάρτιος 25, 2021 12:52 PM EDT

Τόπος

Ocala, FL, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

yargonoth

Ημερομηνία

Ιούλιος 3, 2020 01:43 PM AKDT

Τόπος

Kasilof, AK, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Απρίλιος 25, 2017 05:06 PM AKDT

Τόπος

Sitka, AK (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

drbowser

Ημερομηνία

Φεβρουάριος 12, 2021 11:54 AM EST

Φωτογραφίες / ήχοι

Παρατηρητής

akarcher

Ημερομηνία

Αύγουστος 21, 2018 05:41 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

drbowser

Ημερομηνία

Ιανουάριος 23, 2021 10:37 AM EST

Φωτογραφίες / ήχοι

Παρατηρητής

robertdevelice

Ημερομηνία

Ιανουάριος 13, 2021 12:19 PM AKST
Fungi

Φωτογραφίες / ήχοι

Τι

Μύκητας, Λειχήνα (Βασίλειο Fungi)

Παρατηρητής

stotherah

Ημερομηνία

Αύγουστος 17, 2020 05:54 PM AKDT

Τόπος

Seward, AK, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

drbowser

Ημερομηνία

Ιανουάριος 11, 2021 10:59 AM EST

Φωτογραφίες / ήχοι

Παρατηρητής

drbowser

Ημερομηνία

Ιανουάριος 11, 2021 08:32 AM EST

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Δεκέμβριος 31, 2020 02:22 PM AKST

Περιγραφή

found by @sitkaconnor

Ετικέτες

Φωτογραφίες / ήχοι

Παρατηρητής

jmrobertia

Ημερομηνία

Ιούλιος 22, 2019 12:06 PM AKDT

Περιγραφή

Juvenile male (not entirely sure of the ID) found hunting on some alder limbs at the parking lot of the Bear Mt Trail.

Φωτογραφίες / ήχοι

Παρατηρητής

muir

Ημερομηνία

Νοέμβριος 9, 2016 10:36 AM GMT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 22, 2020 10:54 AM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 22, 2020 10:59 AM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 1, 2020 01:14 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Σεπτέμβριος 12, 2020 09:17 AM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

donnahandley89

Ημερομηνία

Αύγουστος 20, 2015 12:00 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

mckittre

Ημερομηνία

Ιούλιος 3, 2020 10:24 AM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 8, 2020 03:59 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 3, 2020 12:08 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Περιγραφή

Photos include a couple with UV light (one mixed, one only UV), the one in hand shows cap after KOH applied (no significant color change, just mainly got darker).

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 2, 2020 03:01 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

colcan927

Ημερομηνία

Ιούνιος 25, 2020 11:46 AM AKDT

Τόπος

Sterling, AK, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

nealkelso

Ημερομηνία

Ιούνιος 22, 2020 08:43 AM CDT

Τόπος

New Hope, AL, US (Google, OSM)

Περιγραφή

With mite.

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Μάιος 4, 2020 03:46 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Ιούνιος 21, 2018 09:48 AM AKDT

Περιγραφή

on wild rose, Rosa acicularis

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Οκτώβριος 6, 2013 12:59 PM AKDT

Περιγραφή

leaf mines probably a fly

Φωτογραφίες / ήχοι

Παρατηρητής

jmrobertia

Ημερομηνία

Μάιος 28, 2020 02:14 PM AKDT

Περιγραφή

Seen in old burn of Hidden Creek Trail with at least a half dozen other diurnal moths and butterflies.

Φωτογραφίες / ήχοι

Παρατηρητής

jmrobertia

Ημερομηνία

Μάιος 28, 2020 02:18 PM AKDT

Περιγραφή

Seen in old burn of Hidden Creek Trail.

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Απρίλιος 14, 2020 08:02 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

colcan927

Ημερομηνία

Μάιος 28, 2020 02:03 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

muir

Ημερομηνία

Απρίλιος 30, 2020 02:56 PM AKDT

Περιγραφή

Observed in tidal grassland mud. New grass growth not apparent yet.

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Απρίλιος 25, 2020 01:43 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

michiganhummingbirdguy

Ημερομηνία

Ιούνιος 7, 2004

Περιγραφή

Hudsonian Whiteface
(Leucorrhinia hudsonica)
Swanson Lakes, AK
Photo by Allen Chartier
Date Taken : 2004/06/07

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 25, 2019 02:45 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 4, 2019 11:49 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 4, 2019 11:49 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιανουάριος 8, 2016 02:29 PM AKST

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 25, 2015 08:37 PM AKDT

Περιγραφή

Larva from salmonberry leaf miner. collected https://www.inaturalist.org/calendar/gwark/2015/7/21

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 25, 2015 08:30 PM AKDT

Περιγραφή

Pupa from geum leaf miner collected: https://www.inaturalist.org/calendar/gwark/2015/7/21

Φωτογραφίες / ήχοι

Παρατηρητής

robertweeden

Ημερομηνία

Ιούλιος 20, 2019 04:09 PM AKDT

Περιγραφή

on yarrow flowers in open high-grass meadow.

id credit to V. Belov at BugGuide

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Οκτώβριος 24, 2019 09:54 AM AKDT

Περιγραφή

From Sitka spruce

Φωτογραφίες / ήχοι

Παρατηρητής

meagangibson

Ημερομηνία

Αύγουστος 25, 2019 05:00 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

akarcher

Ημερομηνία

Σεπτέμβριος 7, 2019 05:47 PM AKDT

Περιγραφή

First time I have seen wild roses blooming in the fall! Lots of hips on the same plant

Φωτογραφίες / ήχοι

Παρατηρητής

dssikes

Ημερομηνία

Αύγουστος 16, 2019 11:03 PM AKDT

Περιγραφή

4-5 white, flat, worms, 3-5" long. 2 were collected. moist ground after rain, near cooling pond. Observation, photos & collection by Cynthia Pflughoeft.

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Ιούνιος 20, 2019 04:43 PM AKDT

Περιγραφή

On. P. Balsamifera

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Μάιος 29, 2019 03:43 PM AKDT

Τόπος

Homer, AK, USA (Google, OSM)

Περιγραφή

On nettle

Φωτογραφίες / ήχοι

Παρατηρητής

josiahesimmons

Ημερομηνία

Μάιος 23, 2019 03:10 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

stotherah

Ημερομηνία

Μάιος 17, 2019 07:49 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

brucebennett

Ημερομηνία

Ιούνιος 30, 2018 06:38 AM PDT

Περιγραφή

Collected in willow leaf litter. Sent off for identification

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 23, 2014 12:23 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Περιγραφή

Geum macrophyllum

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 23, 2014 12:29 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Περιγραφή

In Rubus spectabilis

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 11, 2018 12:52 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

muir

Ημερομηνία

Νοέμβριος 17, 2018 11:44 AM CET

Τόπος

Brazzaville (Google, OSM)

Περιγραφή

For sale in an open air market.

Φωτογραφίες / ήχοι

Παρατηρητής

kmohatt

Ημερομηνία

Αύγουστος 23, 2010 11:15 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

kmohatt

Ημερομηνία

Αύγουστος 9, 2018 07:09 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

kmohatt

Ημερομηνία

Αύγουστος 25, 2016 02:36 PM AKDT

Περιγραφή

ACCCTTTGTAGTCCTGGAACACCTCTCGAGGCAACTCGGTTTGAGGATTGCCGCTGCTGNTAAGCCGGCTTTCCTTGCGTTCCCGGTCTATGTCTTTATATACCCCATGAATGTAACTGAATGTCTTTAATGGGCCTTAGTGCCTTTAAATCAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTCCAGCTTTTATTAGCTTGGTCAGGCTTGGATGTGGGGGTTGCGGGCTTCTCAGAAGTCGGCTCTCCTTAAATGCATTAGCGGAACCTTTGTTGACCAGCTCTGGTGTGATAATTATCTACGCCATTGCGAAGCAGCTTTAATAATGGGGTTCAGCTTCTAACCGTCCCCTTCACGGGACAACTCTCTGACATTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Σεπτέμβριος 11, 2017 03:57 PM AKDT

Περιγραφή

On Leymus mollis

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Οκτώβριος 15, 2018 09:17 AM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Σεπτέμβριος 29, 2018 03:11 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

domwatts

Ημερομηνία

Ιούλιος 26, 2018

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Αύγουστος 2, 2018 11:13 AM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 14, 2017

Τόπος

Rainbow Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

N. hitchcockii has characteristic triundulate valve margins and pointed apices.

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 19, 2017

Τόπος

Petersen Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

Valves are biundulate. The axial area is wide; sometimes nearly as wide as the central constriction. Differentiated from the similar Staurosira contruens var. binodis based on striae characteristics and valve size.

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Ιούλιος 16, 2018 01:46 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 13, 2018 05:32 AM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούλιος 9, 2018 05:13 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Περιγραφή

parasitic larval stage infecting a jellyfish - collected by visiting researcher @natalie53

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Ιούνιος 24, 2018 12:07 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

muir

Ημερομηνία

Ιούνιος 22, 2018 09:41 PM AKDT

Φωτογραφίες / ήχοι

Παρατηρητής

awenninger

Ημερομηνία

Μάιος 25, 2018 09:05 AM AKDT

Περιγραφή

Reared from Dendroctonus rufipennis host. Emerged 31 May 2018. Keyed to Coeloides rufovariegatus, and sent one to LifeScanner. LifeScanner returns identification to Coeloides genus. When I enter the barcode into the BOLD ID engine, it also matches to "Coeloides" without a species-level match. Coeloides rufovariegatus is the only Coeloides species listed in the Arctos specimen database for Alaska.

DNA: BOLD-2R4: COI-5P: TTTTATATTTTTTTTTTGGTATGTGATCTGGAATATTAGGTTTATCAATAAGTTTAATTATTCGTATAGAATTAAGTATACCTGGTAGAATATTAGGAAATGATCAAATTTATAATGGAATAGTTACTACTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATATTAGGTGGATTTGGAAATTGATTAATTCCATTAATATTAGGTGCTCCGGATATAGCATTTCCTCGAATAAATAATATGAGATTTTGATTATTAATTCCTTCAATTATTTTATTATTATTAAGAAGAATTTTAAATGTTGGTGTAGGTACTGGTTGAACAATTTATCCTCCATTATCTTCATCTTTAGGACATAGGGGATTATCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTATGGGTTCAATTAATTTTATTTCAACAATTTTAAATATACATTTATTTAAATTGGAATTAGATCAATTAACTTTATTGATTTGATCAGTTTTTATTACTACAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGAAATTTGAATACAACTTTTTTTGATTNTCAGGGGGGGG

Φωτογραφίες / ήχοι

Τι

Τάρανδος (Rangifer tarandus)

Παρατηρητής

jmrobertia

Ημερομηνία

Ιούνιος 2018

Περιγραφή

Was literally standing in the Keen-Eye Trail near the KNWR Visitors Center.

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 19, 2017

Τόπος

Petersen Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

E. adnata has valves that are dorsiventral and taper toward rounded rostrate ends. The dorsal margin is convex, while the ventral margin is concave. This species is distinguished from E. turgida based on its finer striae and its larger number of striae per costae.

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 19, 2017

Τόπος

Petersen Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

Valves are biundulate, differentiating them from the nominate variety S. construens. Valves are small with rostrate to subcapitate ends. Differentiated from the similar Pseudostaurosira robusta by striae characteristics and valve size.

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 19, 2017

Τόπος

Petersen Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

Valves are small, cruciform, and have rostrate to subcapitate ends. The central margin is inflated and curved. S. construens is differentiated from Pseudostaurosira pseudoconstruens based on its more narrow central sternum, and from Staurosirella leptostauron based on its narrower striae.

Φωτογραφίες / ήχοι

Παρατηρητής

swiseeagle

Ημερομηνία

Μάιος 14, 2006

Τόπος

Duncan Canal, AK (Google, OSM)

Περιγραφή

Caught by shrimp trawler.

Φωτογραφίες / ήχοι

Παρατηρητής

muir

Ημερομηνία

Μάιος 26, 2018 04:26 PM AKDT

Τόπος

Kincaid Park (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 14, 2017

Τόπος

Rainbow Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

The shape of S. grunowii valves is dinstinctive, with concave margins, but valves that otherwise reflect the characteristics of S. linearis. This species is often cited in the literature as S. linearis var. constricta.

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 14, 2017

Τόπος

Rainbow Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

N. iridis ranges has a large size range and valve shapes can differ. Specimens in this sample closely resemble certain individuals documented by Foged (1981) and Krammer and Lange-Bertalot (1997).

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 19, 2017

Τόπος

Petersen Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

E. turgida valves are dorsiventral and taper toward rostrate ends, and are relatively large for the genus. E. turgida has coarser striae than E. adnata, as well as fewer striae per costae.

Φωτογραφίες / ήχοι

Παρατηρητής

ebroadman

Ημερομηνία

Ιούνιος 19, 2017

Τόπος

Petersen Lake (Google, OSM)

Περιγραφή

Scale bar = 10 µm

Valves are concentrically undulate and large, and are convex or concave. Aereolae are arranged in radiating striae, separated by hyaline costae. S. reimeri is similar, but is smaller, with a lower areolae density.

Φωτογραφίες / ήχοι

Τι

Αρχαιόγναθα (Τάξη Archaeognatha)

Παρατηρητής

treegrow

Ημερομηνία

Σεπτέμβριος 3, 2017 02:16 PM EDT

Περιγραφή

Rock Creek Park, Washington, DC, USA.

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Αύγουστος 17, 2007 06:24 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Απρίλιος 17, 2007 12:39 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

cedric_lee

Ημερομηνία

Δεκέμβριος 2017

Τόπος

California, US (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

hydaticus

Ημερομηνία

Δεκέμβριος 17, 2017 10:29 PM CST

Φωτογραφίες / ήχοι

Παρατηρητής

gwark

Ημερομηνία

Ιούνιος 28, 2006 01:57 PM AKDT

Τόπος

Sitka, AK, USA (Google, OSM)

Φωτογραφίες / ήχοι

Παρατηρητής

treegrow

Ημερομηνία

Ιούλιος 30, 2017 03:38 PM EDT

Περιγραφή

Rock Creek Park, Washington, DC, USA.

Φωτογραφίες / ήχοι

Παρατηρητής

aaronbaldwin

Ημερομηνία

Ιούλιος 14, 2010 11:34 AM AKDT

Τόπος

Homer, AK, USA (Google, OSM)

Περιγραφή

Only Alaskan crangonid lacking dorsal carapace spines. This specimen is infected by the bopyrid isopod Argeia pugettensis.

Φωτογραφίες / ήχοι

Παρατηρητής

nakarb

Ημερομηνία

Ιούνιος 10, 2017 10:07 PM MSK